Polymerase Chain Reaction:Article Title: Hybrid female sterility due to cohesin protection errors in mouse oocytes
Article Snippet: .. The following primers 5′GAATTAATACGACTCACTATAGGCCGGCGCCACCATGCCAGAG3′ and 5′GCCTCCAAAAAAGCCTCCTCACTACTTCTGGAATAGCTCAGAG3′ were used for polymerase chain reaction (PCR) amplification to fuse the T7 promoter sequence to the 5′ end of the sensor construct template DNA. cRNA was synthesized using the template DNA and T7 mMessage mMachine kit (Ambion, catalog no. AM1340) and purified using the MEGAclear kit (Thermo Fisher Scientific, catalog no. AM1908). .. GV-intact prophase I oocytes were microinjected with ~5 pl of cRNA or antibodies in M2 containing 5 μM milrinone, using a micromanipulator TransferMan 4r and FemtoJet 4i (Eppendorf). cRNA used for microinjections was Egfp-Bub1 ( M. m. domesticus or P. maniculatus bairdii BUB1 fused with EGFP at the N terminus, 1184 and 950 ng/μl, respectively), mCherry-Trim21 (Addgene catalog no. 105522, M. musculus domesticus TRIM21 fused with mCherry at the C terminus, 1500 or 3000 ng/μl for BUB1 and REC8 Trim-Away, respectively), and hH2B-mScarlet-hRad21-mNeonGreen [separase sensor, pNM853, human H2B fused with human Rad21 (142 to 476 amino acids) at the C terminus with the Rad21 fragment flanked by two fluorescent proteins, mScarlet and mNeonGreen, 750 ng/μl].
Article Title: Hybrid female sterility due to cohesin protection errors in oocytes
Article Snippet: .. The following primers: 5’GAATTAATACGACTCACTATAGGCCGGCGCCACCATGCCAGAG3’ and 5’GCCTCCAAAAAAGCCTCCTCACTACTTCTGGAATAGCTCAGAG3’ were used for PCR amplification to fuse the T7 promoter sequence to the 5’ end of the sensor construct template DNA. cRNA were synthesized using the template DNA and T7 mMessage mMachine kit (Ambion, cat# AM1340) and purified using the MEGAclear kit (ThermoFisher, cat# AM1908). .. GV-intact prophase I oocytes were microinjected with ∼5 pl of cRNA or antibodies in M2 containing 5 μM milrinone, using a micromanipulator TransferMan 4r and FemtoJet 4i (Eppendorf). cRNA used for microinjections were Egfp-Bub1 ( M. m. domesticus or P. maniculatus bairdii BUB1 fused with EGFP at the N-terminus, 1184 and 950 ng/μl, respectively), mCherry-Trim21 (Addgene cat# 105522, M. musculus domesticus TRIM21 fused with mCherry at the C-terminus, 1500 or 3000 ng/μl for BUB1 and REC8 TrimAway, respectively), and hH2B-mScarlet-hRad21-mNeonGreen (Separase sensor, pNM853, human H2B fused with human Rad21(142-476 a.a.) at the C-terminus with the Rad21 fragment flanked by two fluorescent proteins, mScarlet and mNeonGreen, 750 ng/μl).
Amplification:Article Title: Hybrid female sterility due to cohesin protection errors in mouse oocytes
Article Snippet: .. The following primers 5′GAATTAATACGACTCACTATAGGCCGGCGCCACCATGCCAGAG3′ and 5′GCCTCCAAAAAAGCCTCCTCACTACTTCTGGAATAGCTCAGAG3′ were used for polymerase chain reaction (PCR) amplification to fuse the T7 promoter sequence to the 5′ end of the sensor construct template DNA. cRNA was synthesized using the template DNA and T7 mMessage mMachine kit (Ambion, catalog no. AM1340) and purified using the MEGAclear kit (Thermo Fisher Scientific, catalog no. AM1908). .. GV-intact prophase I oocytes were microinjected with ~5 pl of cRNA or antibodies in M2 containing 5 μM milrinone, using a micromanipulator TransferMan 4r and FemtoJet 4i (Eppendorf). cRNA used for microinjections was Egfp-Bub1 ( M. m. domesticus or P. maniculatus bairdii BUB1 fused with EGFP at the N terminus, 1184 and 950 ng/μl, respectively), mCherry-Trim21 (Addgene catalog no. 105522, M. musculus domesticus TRIM21 fused with mCherry at the C terminus, 1500 or 3000 ng/μl for BUB1 and REC8 Trim-Away, respectively), and hH2B-mScarlet-hRad21-mNeonGreen [separase sensor, pNM853, human H2B fused with human Rad21 (142 to 476 amino acids) at the C terminus with the Rad21 fragment flanked by two fluorescent proteins, mScarlet and mNeonGreen, 750 ng/μl].
Article Title: Hybrid female sterility due to cohesin protection errors in oocytes
Article Snippet: .. The following primers: 5’GAATTAATACGACTCACTATAGGCCGGCGCCACCATGCCAGAG3’ and 5’GCCTCCAAAAAAGCCTCCTCACTACTTCTGGAATAGCTCAGAG3’ were used for PCR amplification to fuse the T7 promoter sequence to the 5’ end of the sensor construct template DNA. cRNA were synthesized using the template DNA and T7 mMessage mMachine kit (Ambion, cat# AM1340) and purified using the MEGAclear kit (ThermoFisher, cat# AM1908). .. GV-intact prophase I oocytes were microinjected with ∼5 pl of cRNA or antibodies in M2 containing 5 μM milrinone, using a micromanipulator TransferMan 4r and FemtoJet 4i (Eppendorf). cRNA used for microinjections were Egfp-Bub1 ( M. m. domesticus or P. maniculatus bairdii BUB1 fused with EGFP at the N-terminus, 1184 and 950 ng/μl, respectively), mCherry-Trim21 (Addgene cat# 105522, M. musculus domesticus TRIM21 fused with mCherry at the C-terminus, 1500 or 3000 ng/μl for BUB1 and REC8 TrimAway, respectively), and hH2B-mScarlet-hRad21-mNeonGreen (Separase sensor, pNM853, human H2B fused with human Rad21(142-476 a.a.) at the C-terminus with the Rad21 fragment flanked by two fluorescent proteins, mScarlet and mNeonGreen, 750 ng/μl).
Sequencing:Article Title: Hybrid female sterility due to cohesin protection errors in mouse oocytes
Article Snippet: .. The following primers 5′GAATTAATACGACTCACTATAGGCCGGCGCCACCATGCCAGAG3′ and 5′GCCTCCAAAAAAGCCTCCTCACTACTTCTGGAATAGCTCAGAG3′ were used for polymerase chain reaction (PCR) amplification to fuse the T7 promoter sequence to the 5′ end of the sensor construct template DNA. cRNA was synthesized using the template DNA and T7 mMessage mMachine kit (Ambion, catalog no. AM1340) and purified using the MEGAclear kit (Thermo Fisher Scientific, catalog no. AM1908). .. GV-intact prophase I oocytes were microinjected with ~5 pl of cRNA or antibodies in M2 containing 5 μM milrinone, using a micromanipulator TransferMan 4r and FemtoJet 4i (Eppendorf). cRNA used for microinjections was Egfp-Bub1 ( M. m. domesticus or P. maniculatus bairdii BUB1 fused with EGFP at the N terminus, 1184 and 950 ng/μl, respectively), mCherry-Trim21 (Addgene catalog no. 105522, M. musculus domesticus TRIM21 fused with mCherry at the C terminus, 1500 or 3000 ng/μl for BUB1 and REC8 Trim-Away, respectively), and hH2B-mScarlet-hRad21-mNeonGreen [separase sensor, pNM853, human H2B fused with human Rad21 (142 to 476 amino acids) at the C terminus with the Rad21 fragment flanked by two fluorescent proteins, mScarlet and mNeonGreen, 750 ng/μl].
Article Title: Hybrid female sterility due to cohesin protection errors in oocytes
Article Snippet: .. The following primers: 5’GAATTAATACGACTCACTATAGGCCGGCGCCACCATGCCAGAG3’ and 5’GCCTCCAAAAAAGCCTCCTCACTACTTCTGGAATAGCTCAGAG3’ were used for PCR amplification to fuse the T7 promoter sequence to the 5’ end of the sensor construct template DNA. cRNA were synthesized using the template DNA and T7 mMessage mMachine kit (Ambion, cat# AM1340) and purified using the MEGAclear kit (ThermoFisher, cat# AM1908). .. GV-intact prophase I oocytes were microinjected with ∼5 pl of cRNA or antibodies in M2 containing 5 μM milrinone, using a micromanipulator TransferMan 4r and FemtoJet 4i (Eppendorf). cRNA used for microinjections were Egfp-Bub1 ( M. m. domesticus or P. maniculatus bairdii BUB1 fused with EGFP at the N-terminus, 1184 and 950 ng/μl, respectively), mCherry-Trim21 (Addgene cat# 105522, M. musculus domesticus TRIM21 fused with mCherry at the C-terminus, 1500 or 3000 ng/μl for BUB1 and REC8 TrimAway, respectively), and hH2B-mScarlet-hRad21-mNeonGreen (Separase sensor, pNM853, human H2B fused with human Rad21(142-476 a.a.) at the C-terminus with the Rad21 fragment flanked by two fluorescent proteins, mScarlet and mNeonGreen, 750 ng/μl).
Construct:Article Title: Hybrid female sterility due to cohesin protection errors in mouse oocytes
Article Snippet: .. The following primers 5′GAATTAATACGACTCACTATAGGCCGGCGCCACCATGCCAGAG3′ and 5′GCCTCCAAAAAAGCCTCCTCACTACTTCTGGAATAGCTCAGAG3′ were used for polymerase chain reaction (PCR) amplification to fuse the T7 promoter sequence to the 5′ end of the sensor construct template DNA. cRNA was synthesized using the template DNA and T7 mMessage mMachine kit (Ambion, catalog no. AM1340) and purified using the MEGAclear kit (Thermo Fisher Scientific, catalog no. AM1908). .. GV-intact prophase I oocytes were microinjected with ~5 pl of cRNA or antibodies in M2 containing 5 μM milrinone, using a micromanipulator TransferMan 4r and FemtoJet 4i (Eppendorf). cRNA used for microinjections was Egfp-Bub1 ( M. m. domesticus or P. maniculatus bairdii BUB1 fused with EGFP at the N terminus, 1184 and 950 ng/μl, respectively), mCherry-Trim21 (Addgene catalog no. 105522, M. musculus domesticus TRIM21 fused with mCherry at the C terminus, 1500 or 3000 ng/μl for BUB1 and REC8 Trim-Away, respectively), and hH2B-mScarlet-hRad21-mNeonGreen [separase sensor, pNM853, human H2B fused with human Rad21 (142 to 476 amino acids) at the C terminus with the Rad21 fragment flanked by two fluorescent proteins, mScarlet and mNeonGreen, 750 ng/μl].
Article Title: Hybrid female sterility due to cohesin protection errors in oocytes
Article Snippet: .. The following primers: 5’GAATTAATACGACTCACTATAGGCCGGCGCCACCATGCCAGAG3’ and 5’GCCTCCAAAAAAGCCTCCTCACTACTTCTGGAATAGCTCAGAG3’ were used for PCR amplification to fuse the T7 promoter sequence to the 5’ end of the sensor construct template DNA. cRNA were synthesized using the template DNA and T7 mMessage mMachine kit (Ambion, cat# AM1340) and purified using the MEGAclear kit (ThermoFisher, cat# AM1908). .. GV-intact prophase I oocytes were microinjected with ∼5 pl of cRNA or antibodies in M2 containing 5 μM milrinone, using a micromanipulator TransferMan 4r and FemtoJet 4i (Eppendorf). cRNA used for microinjections were Egfp-Bub1 ( M. m. domesticus or P. maniculatus bairdii BUB1 fused with EGFP at the N-terminus, 1184 and 950 ng/μl, respectively), mCherry-Trim21 (Addgene cat# 105522, M. musculus domesticus TRIM21 fused with mCherry at the C-terminus, 1500 or 3000 ng/μl for BUB1 and REC8 TrimAway, respectively), and hH2B-mScarlet-hRad21-mNeonGreen (Separase sensor, pNM853, human H2B fused with human Rad21(142-476 a.a.) at the C-terminus with the Rad21 fragment flanked by two fluorescent proteins, mScarlet and mNeonGreen, 750 ng/μl).
Synthesized:Article Title: Hybrid female sterility due to cohesin protection errors in mouse oocytes
Article Snippet: .. The following primers 5′GAATTAATACGACTCACTATAGGCCGGCGCCACCATGCCAGAG3′ and 5′GCCTCCAAAAAAGCCTCCTCACTACTTCTGGAATAGCTCAGAG3′ were used for polymerase chain reaction (PCR) amplification to fuse the T7 promoter sequence to the 5′ end of the sensor construct template DNA. cRNA was synthesized using the template DNA and T7 mMessage mMachine kit (Ambion, catalog no. AM1340) and purified using the MEGAclear kit (Thermo Fisher Scientific, catalog no. AM1908). .. GV-intact prophase I oocytes were microinjected with ~5 pl of cRNA or antibodies in M2 containing 5 μM milrinone, using a micromanipulator TransferMan 4r and FemtoJet 4i (Eppendorf). cRNA used for microinjections was Egfp-Bub1 ( M. m. domesticus or P. maniculatus bairdii BUB1 fused with EGFP at the N terminus, 1184 and 950 ng/μl, respectively), mCherry-Trim21 (Addgene catalog no. 105522, M. musculus domesticus TRIM21 fused with mCherry at the C terminus, 1500 or 3000 ng/μl for BUB1 and REC8 Trim-Away, respectively), and hH2B-mScarlet-hRad21-mNeonGreen [separase sensor, pNM853, human H2B fused with human Rad21 (142 to 476 amino acids) at the C terminus with the Rad21 fragment flanked by two fluorescent proteins, mScarlet and mNeonGreen, 750 ng/μl].
Article Title: Hybrid female sterility due to cohesin protection errors in oocytes
Article Snippet: .. The following primers: 5’GAATTAATACGACTCACTATAGGCCGGCGCCACCATGCCAGAG3’ and 5’GCCTCCAAAAAAGCCTCCTCACTACTTCTGGAATAGCTCAGAG3’ were used for PCR amplification to fuse the T7 promoter sequence to the 5’ end of the sensor construct template DNA. cRNA were synthesized using the template DNA and T7 mMessage mMachine kit (Ambion, cat# AM1340) and purified using the MEGAclear kit (ThermoFisher, cat# AM1908). .. GV-intact prophase I oocytes were microinjected with ∼5 pl of cRNA or antibodies in M2 containing 5 μM milrinone, using a micromanipulator TransferMan 4r and FemtoJet 4i (Eppendorf). cRNA used for microinjections were Egfp-Bub1 ( M. m. domesticus or P. maniculatus bairdii BUB1 fused with EGFP at the N-terminus, 1184 and 950 ng/μl, respectively), mCherry-Trim21 (Addgene cat# 105522, M. musculus domesticus TRIM21 fused with mCherry at the C-terminus, 1500 or 3000 ng/μl for BUB1 and REC8 TrimAway, respectively), and hH2B-mScarlet-hRad21-mNeonGreen (Separase sensor, pNM853, human H2B fused with human Rad21(142-476 a.a.) at the C-terminus with the Rad21 fragment flanked by two fluorescent proteins, mScarlet and mNeonGreen, 750 ng/μl).
Purification:Article Title: Hybrid female sterility due to cohesin protection errors in mouse oocytes
Article Snippet: .. The following primers 5′GAATTAATACGACTCACTATAGGCCGGCGCCACCATGCCAGAG3′ and 5′GCCTCCAAAAAAGCCTCCTCACTACTTCTGGAATAGCTCAGAG3′ were used for polymerase chain reaction (PCR) amplification to fuse the T7 promoter sequence to the 5′ end of the sensor construct template DNA. cRNA was synthesized using the template DNA and T7 mMessage mMachine kit (Ambion, catalog no. AM1340) and purified using the MEGAclear kit (Thermo Fisher Scientific, catalog no. AM1908). .. GV-intact prophase I oocytes were microinjected with ~5 pl of cRNA or antibodies in M2 containing 5 μM milrinone, using a micromanipulator TransferMan 4r and FemtoJet 4i (Eppendorf). cRNA used for microinjections was Egfp-Bub1 ( M. m. domesticus or P. maniculatus bairdii BUB1 fused with EGFP at the N terminus, 1184 and 950 ng/μl, respectively), mCherry-Trim21 (Addgene catalog no. 105522, M. musculus domesticus TRIM21 fused with mCherry at the C terminus, 1500 or 3000 ng/μl for BUB1 and REC8 Trim-Away, respectively), and hH2B-mScarlet-hRad21-mNeonGreen [separase sensor, pNM853, human H2B fused with human Rad21 (142 to 476 amino acids) at the C terminus with the Rad21 fragment flanked by two fluorescent proteins, mScarlet and mNeonGreen, 750 ng/μl].
Article Title: Hybrid female sterility due to cohesin protection errors in oocytes
Article Snippet: .. The following primers: 5’GAATTAATACGACTCACTATAGGCCGGCGCCACCATGCCAGAG3’ and 5’GCCTCCAAAAAAGCCTCCTCACTACTTCTGGAATAGCTCAGAG3’ were used for PCR amplification to fuse the T7 promoter sequence to the 5’ end of the sensor construct template DNA. cRNA were synthesized using the template DNA and T7 mMessage mMachine kit (Ambion, cat# AM1340) and purified using the MEGAclear kit (ThermoFisher, cat# AM1908). .. GV-intact prophase I oocytes were microinjected with ∼5 pl of cRNA or antibodies in M2 containing 5 μM milrinone, using a micromanipulator TransferMan 4r and FemtoJet 4i (Eppendorf). cRNA used for microinjections were Egfp-Bub1 ( M. m. domesticus or P. maniculatus bairdii BUB1 fused with EGFP at the N-terminus, 1184 and 950 ng/μl, respectively), mCherry-Trim21 (Addgene cat# 105522, M. musculus domesticus TRIM21 fused with mCherry at the C-terminus, 1500 or 3000 ng/μl for BUB1 and REC8 TrimAway, respectively), and hH2B-mScarlet-hRad21-mNeonGreen (Separase sensor, pNM853, human H2B fused with human Rad21(142-476 a.a.) at the C-terminus with the Rad21 fragment flanked by two fluorescent proteins, mScarlet and mNeonGreen, 750 ng/μl).
|
Thermo Fisher is a verified supplier 
Thermo Fisher manufactures this product 